Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_0084021 | |||
Gene | PLEKHA2 | Organism | Human |
Genome Locus | chr8:38801306-38803739:+ | Build | hg19 |
Disease | Colorectal Cancer | ICD-10 | Malignant neoplasm of rectosigmoid junction (C19) |
DBLink | Link to database | PMID | 28656150 |
Experimental Method | |||
Sample Type | HCT116 Cell line | Comparison | HCT116 cell lines and Chemoradiation Resistant HCT116 cells |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward CAGCAAGATCACCGTGAGCATA ReverseCAGGGCATTGATAACAAAGCAA | Statistics | Fold Change : Downregulated,2.6 pvalue : p=3.80E − 04 |
Citation | |||
Xiong, W, Ai, YQ, Li, YF, Ye, Q, Chen, ZT, Qin, JY, Liu, QY, Wang, H, Ju, YH, Li, WH, Li, YF (2017). Microarray Analysis of Circular RNA Expression Profile Associated with 5-Fluorouracil-Based Chemoradiation Resistance in Colorectal Cancer Cells. Biomed Res Int, 2017:8421614. |